cdk6 cell signaling technology (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
96
Structured Review
Cell Signaling Technology Inc
cdk6 cell signaling technology
Cdk6 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdk6+cell+signaling+technology/CDK6+Mouse+mAb/pmc12270739__mmc1-19-200-201
Average 96 stars, based on 534 article reviews
Cdk6 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdk6+cell+signaling+technology/CDK6+Mouse+mAb/pmc12270739__mmc1-19-200-201
Average 96 stars, based on 534 article reviews
cdk6 cell signaling technology - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
other:Article Title: Functional inversion of circadian regulator REV-ERBα leads to tumorigenic gene reprogramming Article Snippet: Antibody Vendor Catalog number Dilution REV-ERBa cell signaling technology 13418 1:1000 FOXA1 abcam 23738 1:1000 BRD4 Diagenode C15410337 1:1000 PARP cell signaling technology 9542 1:1000 Article Title: Hepatic Snai1 and Snai2 promote liver regeneration and suppress liver fibrosis in mice Article Snippet: Reagent or Resources (antibody) SOURCE IDENTIFIER IHC Blot αSMA Sigma A5228 1:5000 1:2000 Article Title: Verteporfin-induced proteotoxicity impairs cell homeostasis and survival in neuroblastoma subtypes independent of YAP/TAZ expression Article Snippet: Table 3: Guide RNA sequences for CRISPR/Cas9 -mediated knock-out Target Santa Cruz Biotechnology # gRNAs sequence YAP sc-400040-NIC gRNA1: GGCGACCCAGGCGGCGCCGC gRNA2: GCCGGTTGCCCGGGTCCGGA TAZ sc-400320-NIC gRNA1: TCCAGCACCGACTCGTCGGG gRNA2: CGCGAGTGCGAGCCCGAATC Supplementary Figures Supplementary Figure 1: YAP1 expression positively correlates with MYC expression and negatively correlates with MYCN expression. Article Title: Flavonoid extract Kushenol a exhibits anti-proliferative activity in breast cancer cells via suppression of PI3K/AKT/mTOR pathway. Article Snippet: Working dilutions GAPDH Abcam ab8227 1:5000 P21 Santa Cruz sc- 6246 1:3000 CyclinD1 Abcam ab226977 1:4500 CDK4 Abcam ab137675 1:4500 PI3K Abcam ab32089 1:3500 Imaging:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Software:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Western Blot:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Article Title: CXCL14 Maintains hESC Self-Renewal through Binding to IGF-1R and Activation of the IGF-1R Pathway Article Snippet: .. Antibody Company Catalog Used in CXCL14 GeneTex GTX52666 WB CXCL14 Proteintech 10468-1-AP IF CXCL14 Cloud-Clone Corp. PAB607Hu01 IP TRA-1-60 Santa Cruz sc-21705 IF TRA-1-80 Santa Cruz sc-21706 IF SSEA-3 MybioSource MBS555001 IF SSEA-4 eBioscience 50-8843-82 IF NANOG Cell Signaling Technology #4893 WB NANOG Santa Cruz sc-33759 IF SOX2 Cell Signaling Technology #2748 WB SOX2 GeneTex N1C3 IF OCT4 Santa Cruz sc-9081 IF OCT4 Cell Signaling Technology #2890 WB P21 Cell Signaling Technology #2947 WB P27 Cell Signaling Technology #3686 WB CDK1 Cell Signaling Technology #9112 WB CDK2 Cell Signaling Technology #2546 WB Article Title: TP53 missense–specific transcriptional plasticity drives resistance against cell cycle inhibitors in pancreatic cancer Article Snippet: .. Name Company Catalog Dilution/Amount CDK2 Santa Cruz sc-748 1:500 (WB) Immunohistochemistry:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Article Title: TP53 missense–specific transcriptional plasticity drives resistance against cell cycle inhibitors in pancreatic cancer Article Snippet: .. Name Company Catalog Dilution/Amount CDK2 Santa Cruz sc-748 1:500 (WB) Staining:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Control:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Immunofluorescence:Article Title: Amentoflavone induces caspase-dependent/-independent apoptosis and dysregulates cyclin-dependent kinase-mediated cell cycle in colorectal cancer in vitro and in vivo. Article Snippet: Department of Medical Imaging and Radiological Sciences, Central Taiwan University of Science and Technology, Taichung, Taiwan Department of Radiation Oncology, Chang Bing Show Chwan Memorial Hospital, Changhua, Taiwan Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan Department of Biological Science and Technology, China Medical University, Taichung, Taiwan Department of Radiation Oncology, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan Enzyme-linked Immunosorbent Assay:Article Title: CXCL14 Maintains hESC Self-Renewal through Binding to IGF-1R and Activation of the IGF-1R Pathway Article Snippet: .. Antibody Company Catalog Used in CXCL14 GeneTex GTX52666 WB CXCL14 Proteintech 10468-1-AP IF CXCL14 Cloud-Clone Corp. PAB607Hu01 IP TRA-1-60 Santa Cruz sc-21705 IF TRA-1-80 Santa Cruz sc-21706 IF SSEA-3 MybioSource MBS555001 IF SSEA-4 eBioscience 50-8843-82 IF NANOG Cell Signaling Technology #4893 WB NANOG Santa Cruz sc-33759 IF SOX2 Cell Signaling Technology #2748 WB SOX2 GeneTex N1C3 IF OCT4 Santa Cruz sc-9081 IF OCT4 Cell Signaling Technology #2890 WB P21 Cell Signaling Technology #2947 WB P27 Cell Signaling Technology #3686 WB CDK1 Cell Signaling Technology #9112 WB CDK2 Cell Signaling Technology #2546 WB Immunoprecipitation:Article Title: CXCL14 Maintains hESC Self-Renewal through Binding to IGF-1R and Activation of the IGF-1R Pathway Article Snippet: .. Antibody Company Catalog Used in CXCL14 GeneTex GTX52666 WB CXCL14 Proteintech 10468-1-AP IF CXCL14 Cloud-Clone Corp. PAB607Hu01 IP TRA-1-60 Santa Cruz sc-21705 IF TRA-1-80 Santa Cruz sc-21706 IF SSEA-3 MybioSource MBS555001 IF SSEA-4 eBioscience 50-8843-82 IF NANOG Cell Signaling Technology #4893 WB NANOG Santa Cruz sc-33759 IF SOX2 Cell Signaling Technology #2748 WB SOX2 GeneTex N1C3 IF OCT4 Santa Cruz sc-9081 IF OCT4 Cell Signaling Technology #2890 WB P21 Cell Signaling Technology #2947 WB P27 Cell Signaling Technology #3686 WB CDK1 Cell Signaling Technology #9112 WB CDK2 Cell Signaling Technology #2546 WB Immunohistochemical staining:Article Title: Iron-catalyzed oxidative stress compromises cancer promotional effect of BRCA2 haploinsufficiency through mitochondria-targeted ferroptosis Article Snippet: .. Additional data on cell cycle in Brca2 MUT rats after 3 weeks under renal carcinogenesis protocol. (A) Top enriched gene sets in Brca2 MUT compared to WT by GSEA on kidney at 3 weeks in the Fe-NTA-induced renal carcinogenesis protocol using gene set of “WikiPathways” (n = 3). (B) Enrichment plots of the gene sets associated with iron- sulfur cluster biogenesis. (C) Representative immunohistochemical images of PLIN3 in kidney at 3 weeks of Fe-NTA injection (bar = 100 μm; n = 3 or 4 ; means ± SEM; ns, Maeda Y et al. 4 not significant) Target molecule Supplier Catalogue number BRCA2 PA5-105731 γH2AX 05-636 p16INK4a ab54210 HNEJ-1 xCT NB300-318 GPX4 ab125066 Nrf2 16396-1-AP KEAP1 ab119403 β-actin A1978 pBRCA2 PA5-105585 pGSK3β #5558 GSK3β Invitrogen Merck Abcam In house [1,2] Novus Biologicals Abcam Proteintech Abcam Sigma-Aldrich Invitrogen Cell Signaling Technology Cell Signaling Technology #12456 cleaved caspase-3 Cell Signaling Technology #9664 IRP1 Cell Signaling Technology #20272 IRP2 Cell Signaling Technology #37135 TfR1 Invitrogen #13-6890 FPN Abcam ab235166 FtH Cell Signaling Technology #3998 FtL Abcam ab69090 NCOA4 Novus Biologicals NBP3-18136 DMT1 Abcam ab55735 PCBP1 Biorbyt orb330139 PCBP2 Abnova H00005094-M07 MFN1 Invitrogen PA5-26720 SFXN3 Sigma-Aldrich HPA008028 Ki-67 Abcam ab16667 CDK2 Cell Signaling Technology #2546 Injection:Article Title: Iron-catalyzed oxidative stress compromises cancer promotional effect of BRCA2 haploinsufficiency through mitochondria-targeted ferroptosis Article Snippet: .. Additional data on cell cycle in Brca2 MUT rats after 3 weeks under renal carcinogenesis protocol. (A) Top enriched gene sets in Brca2 MUT compared to WT by GSEA on kidney at 3 weeks in the Fe-NTA-induced renal carcinogenesis protocol using gene set of “WikiPathways” (n = 3). (B) Enrichment plots of the gene sets associated with iron- sulfur cluster biogenesis. (C) Representative immunohistochemical images of PLIN3 in kidney at 3 weeks of Fe-NTA injection (bar = 100 μm; n = 3 or 4 ; means ± SEM; ns, Maeda Y et al. 4 not significant) Target molecule Supplier Catalogue number BRCA2 PA5-105731 γH2AX 05-636 p16INK4a ab54210 HNEJ-1 xCT NB300-318 GPX4 ab125066 Nrf2 16396-1-AP KEAP1 ab119403 β-actin A1978 pBRCA2 PA5-105585 pGSK3β #5558 GSK3β Invitrogen Merck Abcam In house [1,2] Novus Biologicals Abcam Proteintech Abcam Sigma-Aldrich Invitrogen Cell Signaling Technology Cell Signaling Technology #12456 cleaved caspase-3 Cell Signaling Technology #9664 IRP1 Cell Signaling Technology #20272 IRP2 Cell Signaling Technology #37135 TfR1 Invitrogen #13-6890 FPN Abcam ab235166 FtH Cell Signaling Technology #3998 FtL Abcam ab69090 NCOA4 Novus Biologicals NBP3-18136 DMT1 Abcam ab55735 PCBP1 Biorbyt orb330139 PCBP2 Abnova H00005094-M07 MFN1 Invitrogen PA5-26720 SFXN3 Sigma-Aldrich HPA008028 Ki-67 Abcam ab16667 CDK2 Cell Signaling Technology #2546 Chromatin Immunoprecipitation:Article Title: TP53 missense–specific transcriptional plasticity drives resistance against cell cycle inhibitors in pancreatic cancer Article Snippet: .. Name Company Catalog Dilution/Amount CDK2 Santa Cruz sc-748 1:500 (WB) Co-Immunoprecipitation Assay:Article Title: TP53 missense–specific transcriptional plasticity drives resistance against cell cycle inhibitors in pancreatic cancer Article Snippet: .. Name Company Catalog Dilution/Amount CDK2 Santa Cruz sc-748 1:500 (WB) Flow Cytometry:Article Title: TP53 missense–specific transcriptional plasticity drives resistance against cell cycle inhibitors in pancreatic cancer Article Snippet: .. Name Company Catalog Dilution/Amount CDK2 Santa Cruz sc-748 1:500 (WB) |